Molecular Biology Test Bank Chapter 4

1- Restriction enzymes were discovered by

A) Boyer and Cohen.
B) Linn and Arber.
C) Watson and Crick.
D) Gurdon and Linn.
E) Cohen and Gurdon.

... Answer is B)

2- A new enzyme was isolated and found to have a recognition sequence of 5 base pairs. How often will it cut in a genome?

A) 64
B) 4096
C) 8192
D) 1024
E) 3124

... Answer is D)

3- The complementary sequence of one of the following is a palindrome. Which one?

A) GAATTC
B) CTGACT
C) ATCCTC
D) GGCCA
E) CCTTTC

... Answer is A)

4- Which of the following enzymes will produce blunt-ended cuts in DNA?

A) EcoRI
B) HindIII
C) SmaI
D) BamHI
E) PstI

... Answer is D)

5- Which of the following enzymes cannot catalyze the formation of a phosphodiester bond?

A) Endonuclease
B) RNA polymerase
C) DNA polymerase
D) Ligase
E) None of the choices are correct.

... Answer is A)

6- Select the component that is most critical to the function of a plasmid.

A) Tetracycline resistance
B) Ampicillin resistance
C) EcoRI site
D) Origin of replication
E) Ligase

... Answer is D)

7- A molecular biologist is able to select recombinant colonies from a bacterial culture plate based on the color of the colonies. Which of the following is a correct statement?

A) Colonies that contain recombinant plasmids are red.
B) Colonies that contain recombinant plasmids are blue due to the disruption of the lacZ gene the insert.
C) Colonies that contain recombinants are clear/white due to the disruption of the lacZ gene by the insert.
D) Colonies are blue due to the disruption of the ampicillin gene.
E) All of the choices are correct.

... Answer is C)

8- One approach to prevent religation of the ends of a restricted plasmid DNA is to

A) Store the plasmid in DNase.
B) Store the plasmid in RNAase.
C) Treat the plasmid with alkaline phosphatase to remove phosphates from the 'sticky ends'
D) Treat the plasmid with a protease to remove all proteins.
E) Treat the plasmid with BamHI to create gaps.

... Answer is C)

9- A recombinant plasmid was constructed with several restriction enzyme sites and an ampicillin resistance marker. This recombinant was used to transform a host bacteria that also has the ampicillin resistant gene. Which of the following statements is true regarding this experiment?

A) All transformed bacteria will grow on a plate containing ampicillin.
B) All untransformed bacteria will grow on a plate containing ampicillin.
C) It will be difficult to screen for a colony containing a plasmid.
D) A bacterial host that is ampicillin-sensitive should be used for the screening.
E) All of the choices are true.

... Answer is E)

10- Which of the following is true regarding alpha complementation?

A) The plasmid encodes the amino terminal of -galactosidase while the host bacterium encodes the carboxyl portion.
B) The plasmid encodes both amino and carboxyl terminals of the lacZ region.
C) The complete -galactosidase enzyme is made by the host.
D) When the alpha and beta regions fuse they form an inactive peptide.

... Answer is A)

11- A bacterial sample was contaminated with an unknown preparation of vector DNA.In order to identify the vector,the bacteria was streaked on a plate and incubated overnight.Examination of the plate revealed at least 120 clear plaques.Which of the following is a plausible conclusion?

A) The vector could be a plasmid.
B) The vector could be a phage.
C) The vector is a Ti.
D) The vector is puc18.
E) The vector is a cosmid.

... Answer is B)

12- Which of the following vectors is useful in producing singlestranded DNA?

A) puc18
B) Lambda phage
C) M13
D) BAC
E) YAC

... Answer is C)

13- What is the RACE technique?

A) Screening a genomic library
B) Extending incomplete cDNA sequences
C) Generating polynucleotide probes
D) Rapid amplification of genomic DNA
E) Screening a genomic library and generating polynucleotide probes

... Answer is B)

14- The correct 10-base forward PCR primer starting at position 5 on the following sequence would be 5’- ATGCCGATGTAGGGCGGGATGGAGAGATAGAGAGAGTCACA AT-3’

A) 5-GGGATGGCAT
B) 5’-ATGCCGATGT
C) 5’-CGATGTAGGG
D) 5’-GAGTCACAAT
E) 5’-GCTACATCCC

... Answer is E)

15- Which of the following is ideal for screening a protein expression library?

A) Labeled antibodies
B) 3’ RACE
C) 5’ RACE
D) RT-PCR
E) Real-Time PCR

... Answer is A)

16- Which of the following vectors is the best choice for the expression of eukaryotic proteins?

A) M13
B) baculovirus
C) phagemid
D) pUC18
E) pUC19

... Answer is B)

17- A disadvantage of using a prokaryotic expression system for eukaryotic proteins is that the proteins are

A) Highly phosphorylated after translation.
B) Improperly folded.
C) Highly soluble.
D) Heavily glycosylated.
E) Over expressed.

... Answer is B)

18- The "Flavr Savr" tomato is generated by

A) The introduction of plasmids into tomatoes.
B) Introducing the antisense copy of the gene that contributes to ripening.
C) The inhibition of transcription of most genes in the tomato.
D) The introduction of the sense copy of the gene that contributes to ripening.
E) The introduction of plasmids into tomatoes and the introduction of the sense copy of the gene that contributes to ripening are correct

... Answer is B)

19- How many enzymes should be used to cut the plasmid DNA and the insert DNA if there is a desire to ligate the insert within the vector in a specific orientation?

A) 1
B) 2
C) 3
D) 4
E) 5

... Answer is B)

20- In constructing a cDNA library, which of the following would you use to generate rare restriction sites on the cDNA strands?

A) Restriction enzymes
B) PCR with multiple cycles
C) BamHI restriction followed by ligation
D) Ligate cDNA to specific linkers
E) 5’ RACE

... Answer is D)

21- In the construction of an expression vector,which of the following would you include in order to stimulate a high level of RNA synthesis?

A) P3
B) T7 phage promoter
C) Ampr gene
D) His region
E) GFP

... Answer is B)

22- HindIII is so named because it was isolated from Haemophilus influenzae bacterium.

A) True
B) False

... Answer is A)

23- Bacteria use the restriction-modification system to synthesize new DNA molecules.

A) True
B) False

... Answer is B)

24- A fragment restricted with EcoRI enzyme can be used for ligation into a plasmid that was restricted with BamHI because both the insert and the plasmid contain sticky ends.

A) True
B) False

... Answer is B)

25- In a replacement vector, a portion of the DNA is removed to accommodate the fragment to be inserted.

A) True
B) False

... Answer is A)

26- Polynucleotide probes can be used to screen a genomic library for specific genomic sequences.

A) True
B) False

... Answer is A)

27- A group of identical cells is called a __________.

28- An enzyme that recognizes different sites in an identical sequence is called a ____________.

29- The use of high voltage to drive DNA into cells is called _____________.

30- A fusion protein can easily be isolated by ____________________ chromatography.

1-26 : MCQ questions
27-30 : Fill Blank questions

الشابتر:12345التالي

Powered by Issa Aldababseh